PKIG (NM_001281444) Human Untagged Clone
CAT#: SC333374
PKIG (untagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor gamma (PKIG), transcript variant 4
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PKI-gamma |
Vector | pCMV6-Entry |
Sequence Data |
>SC333374 representing NM_001281444.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATGGAGGTCGAGTCCTCCTACTCGGACTTCATCTCCTGTGACCGGACAGGCCGTCGGAATGCGGTC CCTGACATCCAGGGAGACTCAGAGGCTGTGAGCGTGAGGAAGCTGGCTGGAGACATGGGCGAGCTGGCA CTCGAGGGGGCAGAAGGACAGGTGGAGGGAAGCGCCCCAGACAAGGAAGCTGGCAACCAGCCCCAGAGC AGCGATGGGACCACCTCGTCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281444 |
Insert Size | 231 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001281444.1 |
RefSeq Size | 1623 bp |
RefSeq ORF | 231 bp |
Locus ID | 11142 |
UniProt ID | Q9Y2B9 |
Protein Families | Druggable Genome |
MW | 7.9 kDa |
Gene Summary | This gene encodes a member of the protein kinase inhibitor family. Studies of a similar protein in mice suggest that this protein acts as a potent competitive cAMP-dependent protein kinase inhibitor, and is a predominant form of inhibitor in various tissues. The encoded protein may be involved in osteogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (4) represents the longest transcript. Variants 1-5 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235480 | PKIG (myc-DDK-tagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor gamma (PKIG), transcript variant 4 |
CNY 1,200.00 |
|
RG235480 | PKIG (tGFP-tagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor gamma (PKIG), transcript variant 4 |
CNY 4,370.00 |