NDUFA5 (NM_001282422) Human Untagged Clone
CAT#: SC333380
NDUFA5 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 5
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B13; CI-13kB; CI-13KD-B; NUFM; UQOR13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333380 representing NM_001282422.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTGGGATTGGCTGTGTGCAATACTCCTCACGAGGAA CCAGATGTTAAAAAATTAGAAGACCAACTTCAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAA CATGAACTAAATCTGGCAAGAAAAATGAGGGAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCT GCCGATCAGTGGAAATGGCCAATATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282422 |
Insert Size | 234 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282422.2 |
RefSeq Size | 5485 bp |
RefSeq ORF | 234 bp |
Locus ID | 4698 |
UniProt ID | Q16718 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 8.8 kDa |
Gene Summary | This nuclear gene encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. The encoded protein localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (5) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (5) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235486 | NDUFA5 (myc-DDK-tagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 5 |
CNY 3,990.00 |
|
RG235486 | NDUFA5 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 5 |
CNY 4,370.00 |