DOK5 (NM_001294161) Human Untagged Clone

CAT#: SC333387

DOK5 (untagged) - Human docking protein 5 (DOK5), transcript variant 3



  "NM_001294161" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-DOK5 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C20orf180; IRS-6; IRS6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333387 representing NM_001294161.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCCAATTTTAATGACATAGTGAAGCAAGGGTACGTGAGGATCCGGAGCAGACGCCTCGGGGTG
CTGATCCTGAGAGCCCTCCGCAGTGAACACCCTGCATGCAGATCTCCTTCTTGGAACCTGTTCCTGGAA
AACCCAGTCTCCAGCAACCTGATATGTAACTGCAAATCTGCAACTCTAGACCAACCTTCTAAAGAGGGA
TTTAAGACCTTTTTCAAGAATCTGGCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001294161
Insert Size 237 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001294161.1
RefSeq Size 907 bp
RefSeq ORF 237 bp
Locus ID 55816
Protein Families Druggable Genome
MW 8.9 kDa
Gene Summary The protein encoded by this gene is a member of the DOK family of membrane proteins, which are adapter proteins involved in signal transduction. The encoded protein interacts with phosphorylated receptor tyrosine kinases to mediate neurite outgrowth and activation of the MAP kinase pathway. Unlike other DOK family proteins, this protein does not interact with RASGAP. This protein is up-regulated in patients with systemic sclerosis and is associated with fibrosis induced by insulin-like growth factor binding protein 5. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (3) shares the same 5' terminal exon, and lacks the remaining exons but contains an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is significantly shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...