UCMA (NM_001303118) Human Untagged Clone

CAT#: SC333548

UCMA (untagged) - Human upper zone of growth plate and cartilage matrix associated (UCMA), transcript variant 2



  "NM_001303118" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal UCMA Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C10orf49; GRP; GRP/UCMA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333548 representing NM_001303118.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTTGGAGACAGGCCGTCCTGCTGTCTTGCTTCTCCGCCGTGGTGCTCCTGTCTATGCTGAGAGAG
GGAACCAGTGTATCTGTGGGCACCATGCAGATGGCGGGAGAAGAGGCGAGTGAAGTGGAAAACAGGCAG
AAGCTTCGGGTTGATGAGCTGCGGAGAGAATATTACGAGGAACAAAGGAATGAATTTGAGAACTTCGTG
GAGGAACAAAACGATGAGCAGGAAGAGAGGAGCCGGGAGGCTGTGGAGCAGTGGCGCCAGTGGCACTAT
GACGGCCTGCACCCATCCTATCTCTACAACCGCCACCACACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001303118
Insert Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303118.1
RefSeq Size 728 bp
RefSeq ORF 321 bp
Locus ID 221044
UniProt ID Q8WVF2
Protein Families Secreted Protein
MW 12.8 kDa
Gene Summary This gene encodes a chondrocyte-specific, highly charged protein that is abundantly expressed in the upper immature zone of fetal and juvenile epiphyseal cartilage. The encoded protein undergoes proteolytic processing to generate a mature protein that is secreted into the extracellular matrix. The glutamic acid residues in the encoded protein undergo gamma carboxylation in a vitamin K-dependent manner. Undercarboxylation of the encoded protein is associated with osteoarthritis in humans. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...