SNRPD3 (NM_001278656) Human Untagged Clone
CAT#: SC333730
SNRPD3 (untagged) - Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Sm-D3; SMD3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333730 representing NM_001278656.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCTATTGGTGTGCCGATTAAAGTACTGCATGAGGCCGAGGGCCACATTGTGACATGTGAGACGAAC ACCGGTGAGGTATATCGGGGGAAGCTCATTGAAGCAGAGGACAACATGAACTGCCAGATGTCCAACATC ACAGTCACATACAGAGATGGCCGAGTGGCACAGCTGGAGCAGGTATACATCCGTGGCAGCAAAATCCGC TTTCTGATTTTGCCTGACATGCTGAAGAACGCACCCATGTTAAAGAGCATGAAAAATAAAAACCAAGGC TCAGGGGCTGGCCGAGGAAAAGCTGCTATTCTCAAGGCCCAAGTGGCCGCAAGAGGAAGAGGACGTGGA ATGGGACGTGGAAACATCTTTCAAAAGCGAAGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278656 |
Insert Size | 381 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278656.1 |
RefSeq Size | 3794 bp |
RefSeq ORF | 381 bp |
Locus ID | 6634 |
UniProt ID | P62318 |
Protein Families | Druggable Genome |
Protein Pathways | Spliceosome, Systemic lupus erythematosus |
MW | 13.9 kDa |
Gene Summary | This gene encodes a core component of the spliceosome, which is a nuclear ribonucleoprotein complex that functions in pre-mRNA splicing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235836 | SNRPD3 (myc-DDK-tagged) - Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3), transcript variant 2 |
CNY 1,200.00 |
|
RG235836 | SNRPD3 (tGFP-tagged) - Human small nuclear ribonucleoprotein D3 polypeptide 18kDa (SNRPD3), transcript variant 2 |
CNY 4,370.00 |