CHCHD10 (NM_001301339) Human Untagged Clone

CAT#: SC333967

CHCHD10 (untagged) - Human coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10), transcript variant 1



  "NM_001301339" in other vectors (2)

CNY 1,320.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CHCHD10 mouse monoclonal antibody,clone OTI3B8
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C22orf16; FTDALS2; IMMD; MIX17A; N27C7-4; SMAJ
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301339, the custom clone sequence may differ by one or more nucleotides


ATGCCTCGGGGAAGCCGCAGCGCGGCCTCCCGGCCAGCCAGCCGCCCAGCCGCGCCCTCTGCCCACCCGC
CCGCGCACCCACCGCCCTCGGCAGCCGCCCCAGCCCCCGCCCCTTCGGGCCAGCCGGGGCTCATGGCTCA
GATGGCGACCACGGCCGCAGGGGTAGCCGTGGGCTCGGCTGTGGGACACGTCATGGGCAGCGCCCTGACC
GGAGCCTTCAGCGGGGGGAGCTCGGAGCCCTCCCAGCCTGCTGTCCAGCAGCCTCTTGCACTGTACCCCC
AGGCCCCCACCCCCGCTGCCCCCCAGCCCCTGCAGATGGGGCCCTGCGCCTACGAGATCAGGCAGTTCCT
GGACTGTTCCACCACTCAGAGTGACCTGTCCCTGTGTGAGGGCTTCAGCGAGGCCCTGAAGCAGTGCAAG
TACTACCATGGTCTGAGCTCCCTGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301339
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301339.1, NP_001288268.1
RefSeq Size 739 bp
RefSeq ORF 450 bp
Locus ID 400916
UniProt ID Q8WYQ3
Gene Summary This gene encodes a mitochondrial protein that is enriched at cristae junctions in the intermembrane space. It may play a role in cristae morphology maintenance or oxidative phosphorylation. Mutations in this gene cause frontotemporal dementia and/or amyotrophic lateral sclerosis-2. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 7 and 19. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...