CHCHD10 (NM_001301339) Human Untagged Clone
CAT#: SC333967
CHCHD10 (untagged) - Human coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10), transcript variant 1
CNY 1,320.00
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C22orf16; FTDALS2; IMMD; MIX17A; N27C7-4; SMAJ |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301339, the custom clone sequence may differ by one or more nucleotides
ATGCCTCGGGGAAGCCGCAGCGCGGCCTCCCGGCCAGCCAGCCGCCCAGCCGCGCCCTCTGCCCACCCGC CCGCGCACCCACCGCCCTCGGCAGCCGCCCCAGCCCCCGCCCCTTCGGGCCAGCCGGGGCTCATGGCTCA GATGGCGACCACGGCCGCAGGGGTAGCCGTGGGCTCGGCTGTGGGACACGTCATGGGCAGCGCCCTGACC GGAGCCTTCAGCGGGGGGAGCTCGGAGCCCTCCCAGCCTGCTGTCCAGCAGCCTCTTGCACTGTACCCCC AGGCCCCCACCCCCGCTGCCCCCCAGCCCCTGCAGATGGGGCCCTGCGCCTACGAGATCAGGCAGTTCCT GGACTGTTCCACCACTCAGAGTGACCTGTCCCTGTGTGAGGGCTTCAGCGAGGCCCTGAAGCAGTGCAAG TACTACCATGGTCTGAGCTCCCTGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301339 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301339.1, NP_001288268.1 |
RefSeq Size | 739 bp |
RefSeq ORF | 450 bp |
Locus ID | 400916 |
UniProt ID | Q8WYQ3 |
Gene Summary | This gene encodes a mitochondrial protein that is enriched at cristae junctions in the intermembrane space. It may play a role in cristae morphology maintenance or oxidative phosphorylation. Mutations in this gene cause frontotemporal dementia and/or amyotrophic lateral sclerosis-2. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 7 and 19. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236073 | CHCHD10 (myc-DDK-tagged) - Human coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10), transcript variant 1 |
CNY 1,320.00 |
|
RG236073 | CHCHD10 (tGFP-tagged) - Human coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10), transcript variant 1 |
CNY 4,370.00 |
其它CHCHD10产品