CLEC5A (NM_001301167) Human Untagged Clone

CAT#: SC334098

CLEC5A (untagged) - Human C-type lectin domain family 5, member A (CLEC5A), transcript variant 2



  "NM_001301167" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CLEC5A Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLECSF5; MDL-1; MDL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334098 representing NM_001301167.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTGGCACATGATCATCTCTGGGCTTATTGTGGTAGTGCTTAAAGTTGTTGGAATGACCTTATTT
CTACTTTATTTCCCACAGATTTTTAACAAAAGTAACGATGGTTTCACCACCACCAGGAGCTATGGAACA
GTCTGCCCCAAAGACTGGGAATTTTATCAAGCAAGATGTTTTTTCTTATCCACTTCTGAATCATCTTGG
AATGAAAGCAGGGACTTTTGCAAAGGAAAAGGATCCACATTGGCAATTGTCAACACGCCAGAGAAACTG
AAGTTTCTTCAGGACATAACTGATGCTGAGAAGTATTTTATTGGCTTAATTTACCATCGTGAAGAGAAA
AGGTGGCGTTGGATCAACAACTCTGTGTTCAATGGCAATGTTACCAATCAGAATCAGAATTTCAACTGT
GCGACCATTGGCCTAACAAAGACATTTGATGCTGCATCATGTGACATCAGCTACCGCAGGATCTGTGAG
AAGAATGCCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301167
Insert Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301167.1
RefSeq Size 3466 bp
RefSeq ORF 498 bp
Locus ID 23601
Protein Families Druggable Genome, Transmembrane
MW 19.1 kDa
Gene Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein interacts with dnax-activation protein 12 and may play a role in cell activation. Alternative splice variants have been described but their full-length sequence has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...