DIABLO (NM_001278303) Human Untagged Clone

CAT#: SC334103

DIABLO (untagged) - Human diablo, IAP-binding mitochondrial protein (DIABLO), transcript variant 6



  "NM_001278303" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-DIABLO Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNA64; SMAC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334103 representing NM_001278303.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGAGAGCAGTGTCTTTGGTAACAGATAGCACCTCTACCTTTCTCTCTCAGACCACATATGCGTTG
ATTGAAGCTATTACTGAATATACTAAGGCTGTTTATACCTTAACTTCTCTTTACCGACAATATACAAGT
TTACTTGGGAAAATGAATTCAGAGGAGGAAGATGAAGTGTGGCAGGTGATCATAGGAGCCAGAGCTGAG
ATGACTTCAAAACACCAAGAGTACTTGAAGCTGGAAACCACTTGGATGACTGCAGTTGGTCTTTCAGAG
ATGGCAGCAGAAGCTGCATATCAAACTGGCGCAGATCAGGCCTCTATAACCGCCAGGAATCACATTCAG
CTGGTGAAACTGCAGGTGGAAGAGGTGCACCAGCTCTCCCGGAAAGCAGAAACCAAGCTGGCAGAAGCA
CAGATAGAAGAGCTCCGTCAGAAAACACAGGAGGAAGGGGAGGAGCGGGCTGAGTCGGAGCAGGAGGCC
TACCTGCGTGAGGATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278303
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278303.1
RefSeq Size 1881 bp
RefSeq ORF 501 bp
Locus ID 56616
UniProt ID Q9NR28
Protein Families Transmembrane
MW 18.9 kDa
Gene Summary This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (5, also known as Smac-gamma) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...