Uridine Phosphorylase 1 (UPP1) (NM_001287428) Human Untagged Clone
CAT#: SC334165
UPP1 (untagged) - Human uridine phosphorylase 1 (UPP1), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UDRPASE; UP; UPASE; UPP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287428, the custom clone sequence may differ by one or more nucleotides
ATGCAGAGAAAGCTGAAAGTCACAAGTCTGGAGCCCGGCACTGTGGTCATAACAGAGCAGGCAGTGGATA CCTGCTTCAAGGCAGAGTTTGAGCAGATTGTCCTGGGGAAGCGGGTCATCCGGAAAACGGACCTTAACAA GAAGCTGGTGCAGGAGCTGTTGCTGTGTTCTGCAGAGCTGAGCGAGTTCACCACAGTGGTGGGGAACACC ATGTGCACCTTGGACTTCTATGAAGGGCAAGGCCGTCTGGATGGGGCTCTCTGCTCCTACACGGAGAAGG ACAAGCAGGCGTATCTGGAGGCAGCCTATGCAGCCGGCGTCCGCAATATCGAGATGGAGTCCTCGGTGTT TGCCGCCATGTGCAGCGCCTGCGGCCTCCAAGCGGCCGTGGTGTGTGTCACCCTCCTGAACCGCCTGGAA GGGGACCAGATCAGCAGCCCTCGCAATGTGCTCAGCGAGTACCAGCAGAGGCCGCAGCGGCTGGTGAGCT ACTTCATCAAGAAGAAACTGAGCAAGGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287428 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287428.1, NP_001274357.1 |
RefSeq Size | 1587 bp |
RefSeq ORF | 522 bp |
Locus ID | 7378 |
UniProt ID | Q16831 |
Protein Pathways | Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism |
Gene Summary | This gene encodes a uridine phosphorylase, an enzyme that catalyzes the reversible phosphorylation of uridine (or 2'- deoxyuridine) to uracil and ribose-1-phosphate (or deoxyribose-1-phosphate). The encoded enzyme functions in the degradation and salvage of pyrimidine ribonucleosides. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (4) differs in the 5' UTR, lacks three exons in the 5' coding region and initiates translation at an alternate start codon, compared to variant 8. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Variants 4, 5 and 6 all encode isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...