BORCS5 (NM_001300742) Human Untagged Clone
CAT#: SC334191
LOH12CR1 (untagged) - Human loss of heterozygosity, 12, chromosomal region 1 (LOH12CR1), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
LOH12CR1 mouse monoclonal antibody, clone OTI1E1 (formerly 1E1)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LOH1CR12; LOH12CR1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300742, the custom clone sequence may differ by one or more nucleotides
ATGACTCCTTCACCAGCCAAGCATAGAGCCAAGATGGATGATATTGTGGTTGTAGCTCAGGGCTCCCAGG CCTCACGGAACGTCAGCAACGATCCCGATGTCATCAAGTTGCAAGAGATTCCAACCTTCCAGCCCCTTTT GAAAGGGCTATTGAGTGGCCAGACTTCCCCAACAAATGCCAAATTGGAGAAACTGGACTCTCAGCAGGTG TTGCAGCTCTGCCTCCGATATCAAGATCACCTGCATCAGTGTGCAGAGGCCGTTGCTTTTGACCAGAATG CTTTGGTTAAACGAATCAAAGAGATGGATCTGTCTGTAGAAACTCTGTTCAGCTTCATGCAGGAGCGCCA GAAAAGATACGCCAAGTATGCCGAGCAGATCCAGAAAGTGAACGAGATGTCCGCCATCCTCCGCCGCATA CAGATGGGCATCGACCAGACTGTGCCCCTGCTGGACAGGCTCAACAGCATGCTGCCCGAGGGCGAGCGGC TGGAGCCCTTCAGCATGAAGCCCGACCGCGAGCTCAGGCTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300742 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300742.1, NP_001287671.1 |
RefSeq Size | 1701 bp |
RefSeq ORF | 534 bp |
Locus ID | 118426 |
UniProt ID | Q969J3 |
Gene Summary | As part of the BORC complex may play a role in lysosomes movement and localization at the cell periphery. Associated with the cytosolic face of lysosomes, the BORC complex may recruit ARL8B and couple lysosomes to microtubule plus-end-directed kinesin motor. Thereby, it may indirectly play a role in cell spreading and motility.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 5' terminal exon, resulting in the use of an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus, and is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...