TNFRSF14 (NM_001297605) Human Untagged Clone
CAT#: SC334261
TNFRSF14 (untagged) - Human tumor necrosis factor receptor superfamily, member 14 (TNFRSF14), transcript variant 2
CNY 2,640.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATAR; CD270; HVEA; HVEM; LIGHTR; TR2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297605, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCTCCTGGAGACTGGGGGCCTCCTCCCTGGAGATCCACCCCCAAAACCGACGTCTTGAGGCTGG TGCTGTATCTCACCTTCCTGGGAGCCCCCTGCTACGCCCCAGCTCTGCCGTCCTGCAAGGAGGACGAGTA CCCAGTGGGCTCCGAGTGCTGCCCCAAGTGCAGTCCAGGTTATCGTGTGAAGGAGGCCTGCGGGGAGCTG ACGGGCACAGTGTGTGAACCCTGCCCTCCAGGCACCTACATTGCCCACCTCAATGGCCTAAGCAAGTGTC TGCAGTGCCAAATGTGTGACCCAGCCATGGGCCTGCGCGCGAGCCGGAACTGCTCCAGGACAGAGAACGC CGTGTGTGGCTGCAGCCCAGGCCACTTCTGCATCGTCCAGGACGGGGACCACTGCGCCGCGTGCCGCGCT TACGCCACCTCCAGCCCGGGCCAGAGGGTGCAGAAGGGAGGCACCGAGAGTCAGGACACCCTGTGTCAGA ACTGCCCCCCGGGGACCTTCTCTCCCAATGGGACCCTGGAGGAATGTCAGCACCAGACCAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297605 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001297605.1, NP_001284534.1 |
RefSeq Size | 3376 bp |
RefSeq ORF | 555 bp |
Locus ID | 8764 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | This gene encodes a member of the TNF (tumor necrosis factor) receptor superfamily. The encoded protein functions in signal transduction pathways that activate inflammatory and inhibitory T-cell immune response. It binds herpes simplex virus (HSV) viral envelope glycoprotein D (gD), mediating its entry into cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236367 | TNFRSF14 (myc-DDK-tagged) - Human tumor necrosis factor receptor superfamily, member 14 (TNFRSF14), transcript variant 2 |
CNY 3,990.00 |
|
RG236367 | TNFRSF14 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 14 (TNFRSF14), transcript variant 2 |
CNY 4,370.00 |
其它TNFRSF14产品