KCNIP1 (NM_001278340) Human Untagged Clone
CAT#: SC334297
KCNIP1 (untagged) - Human Kv channel interacting protein 1 (KCNIP1), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KCHIP1; VABP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278340, the custom clone sequence may differ by one or more nucleotides
ATGACCATGGTTTGCCATCGGCCCGAGGGACTGGAGCAGCTCGAGGCCCAGACCAACTTCACCAAGAGGG AGCTGCAGGTCCTTTATCGAGGCTTCAAAAATGAGTGCCCCAGTGGTGTGGTCAACGAAGACACATTCAA GCAGATCTATGCTCAGTTTTTCCCTCATGGAGATGCCAGCACGTATGCCCATTACCTCTTCAATGCCTTC GACACCACTCAGACAGGCTCCGTGAAGTTCGAGGACTTTGTAACCGCTCTGTCGATTTTATTGAGAGGAA CTGTCCACGAGAAACTAAGGTGGACATTTAATTTGTATGACATCAACAAGGACGGATACATAAACAAAGA GGAGATGATGGACATTGTCAAAGCCATCTATGACATGATGGGGAAATACACATATCCTGTGCTCAAAGAG GACACTCCAAGGCAGCATGTGGACGTCTTCTTCCAGAAAATGGACAAAAATAAAGATGGCATCGTAACTT TAGATGAATTTCTTGAATCATGTCAGGAGGACGACAACATCATGAGGTCTCTCCAGCTGTTTCAAAATGT CATGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278340 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278340.1, NP_001265269.1 |
RefSeq Size | 2190 bp |
RefSeq ORF | 567 bp |
Locus ID | 30820 |
UniProt ID | Q9NZI2 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] Transcript Variant: This variant (4) differs in the 5' UTR, uses an alternate in-frame splice site in the 5' coding region and initiates translation at a downstream start codon, compared to variant 5. It encodes isoform 4 which is shorter than isoform 5. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...