COA8 (NM_001302653) Human Untagged Clone

CAT#: SC334319

APOPT1 (untagged) - Human apoptogenic 1, mitochondrial (APOPT1), transcript variant 3



  "NM_001302653" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-APOPT1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APOP; APOP1; APOPT1; C14orf153; MC4DN17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302653, the custom clone sequence may differ by one or more nucleotides


ATGCTGCCGTGCGCCGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCGGGCGGGGAAGAAGACCT
TTCTCCCCCCTCTCTGCCGCGCCTTCGCCTGCCGCGGCTGTCAACTCGCTCCGGAGCGCGGCGCCGAGCG
CAGGGATACGGCGCCCAGCGGGGTCTCAAGATTCTGCCCTCCAAGAAAGTCTTGCCATGATTGGATAGGA
CCCCCAGATAAATATTCAAACCTTCGACCTGTTCACTTTTACATACCTGAAAATGAATCTCCATTGGAAC
AAAAGCTTAGAAAATTAAGACAAGAAACACAAGAATGGAATCAACAGTTCTGGGCAAACCAGAATTTGAC
TTTTAGTAAGGAAAAAGAAGAATTTATTCACTCAAGACTAAAAACTAAAGGCCTGGGCCTGAGAACTGAA
TCAGACCCCACTTTACCTCGGGTAACTGAAACCATGGAAAGAAAAACCATGGATGGAGGGGACAGCTGTG
CTGCCGCCATCTCCCTTACACAGTCAGAAAGCAACATTGAATGCAGAAGAAATGGCGGACTTCTACAAGG
AATTTTTAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001302653
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302653.1, NP_001289582.1
RefSeq Size 1337 bp
RefSeq ORF 573 bp
Locus ID 84334
UniProt ID Q96IL0
Protein Families Secreted Protein
Gene Summary This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (3) has a shorter 3' UTR, and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a distinct, shorter C-terminus than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...