ELOVL7 (NM_001297618) Human Untagged Clone

CAT#: SC334364

ELOVL7 (untagged) - Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 4



  "NM_001297618" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal ELOVL7 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297618, the custom clone sequence may differ by one or more nucleotides


ATGTCTGGCTGGGGTATAGGTTATTCATTTCGATGTGACATTGTTGACTATTCACGGTCACCCACAGCTT
TGAGGATGGCACGTACCTGCTGGCTTTATTACTTCTCCAAATTTATTGAGCTATTAGATACGATCTTTTT
TGTTCTGCGCAAGAAAAATAGCCAAGTGACTTTCCTTCATGTATTCCATCATACCATCATGCCGTGGACC
TGGTGGTTTGGAGTCAAATTTGCTGCAGGTGGTTTGGGAACATTCCATGCCCTTCTAAATACAGCTGTAC
ATGTAGTCATGTATTCCTACTATGGACTTTCTGCATTGGGGCCAGCCTACCAGAAGTATTTGTGGTGGAA
AAAATATTTGACATCATTACAGCTTGTCCAGTTTGTTATTGTCGCCATCCACATAAGCCAGTTCTTTTTC
ATGGAGGATTGCAAGTATCAGTTTCCAGTCTTTGCGTGCATCATTATGAGTTACAGTTTCATGTTTCTGC
TGCTCTTTCTCCATTTTTGGTACCGTGCTTACACCAAAGGTCAGAGGTTGCCCAAAACTGTGAAAAATGG
AACTTGCAAAAACAAAGATAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001297618
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297618.1, NP_001284547.1
RefSeq Size 3856 bp
RefSeq ORF 585 bp
Locus ID 79993
UniProt ID A1L3X0
Protein Families Transmembrane
Gene Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme with higher activity toward C18 acyl-CoAs, especially C18:3(n-3) acyl-CoAs and C18:3(n-6)-CoAs. Also active toward C20:4-, C18:0-, C18:1-, C18:2- and C16:0-CoAs, and weakly toward C20:0-CoA. Little or no activity toward C22:0-, C24:0-, or C26:0-CoAs. May participate in the production of saturated and polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) has an alternate splice site, which causes translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...