HMG4 (HMGB3) (NM_001301228) Human Untagged Clone
CAT#: SC334410
HMGB3 (untagged) - Human high mobility group box 3 (HMGB3), transcript variant 1
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HMG-2a; HMG-4; HMG2A; HMG4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301228, the custom clone sequence may differ by one or more nucleotides
ATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAAGATGTCCGCTTATGCCTTCTTTGTGCAGACATGCA GAGAAGAACATAAGAAGAAAAACCCAGAGGTCCCTGTCAATTTTGCGGAATTTTCCAAGAAGTGCTCTGA GAGGTGGAAGACGATGTCCGGGAAAGAGAAATCTAAATTTGATGAAATGGCAAAGGCAGATAAAGTGCGC TATGATCGGGAAATGAAGGATTATGGACCAGCTAAGGGAGGCAAGAAGAAGAAGGATCCTAATGCTCCCA AAAGGCCACCGTCTGGATTCTTCCTGTTCTGTTCAGAATTCCGCCCCAAGATCAAATCCACAAACCCCGG CATCTCTATTGGAGACGTGGCAAAAAAGCTGGGTGAGATGTGGAATAATTTAAATGACAGTGAAAAGCAG CCTTACATCACTAAGGCGGCAAAGCTGAAGGAGAAGTATGAGAAGGATGTTGCTGACTATAAGTCGAAAG GAAAGTTTGATGGTGCAAAGGGTCCTGCTAAAGTTGCCCGGAAAAAGGTGGAAGAGGAAGATGAAGAAGA GGAGGAGGAAGAAGAGGAGGAGGAGGAGGAGGAGGATGAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301228 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001301228.1, NP_001288157.1 |
RefSeq Size | 3676 bp |
RefSeq ORF | 603 bp |
Locus ID | 3149 |
UniProt ID | O15347 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of a family of proteins containing one or more high mobility group DNA-binding motifs. The encoded protein plays an important role in maintaining stem cell populations, and may be aberrantly expressed in tumor cells. A mutation in this gene was associated with microphthalmia, syndromic 13. There are numerous pseudogenes of this gene on multiple chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the shorter isoform (a). Variants 1, 2, and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...