Securin (PTTG1) (NM_001282382) Human Untagged Clone

CAT#: SC334421

PTTG1 (untagged) - Human pituitary tumor-transforming 1 (PTTG1), transcript variant 1



  "NM_001282382" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-PTTG1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EAP1; HPTTG; PTTG; TUTR1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282382, the custom clone sequence may differ by one or more nucleotides


ATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCTAAGGATGGGC
TGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGTTTTGG
CAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGAACTGTCAACAGAGCT
ACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGA
CTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATT
CTTTCCCTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC
TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCC
CTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATTCTGTC
GACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATAGATATTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282382
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282382.1, NP_001269311.1
RefSeq Size 1093 bp
RefSeq ORF 609 bp
Locus ID 9232
UniProt ID O95997
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Cell cycle, Oocyte meiosis
Gene Summary The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...