Securin (PTTG1) (NM_001282383) Human Untagged Clone
CAT#: SC334422
PTTG1 (untagged) - Human pituitary tumor-transforming 1 (PTTG1), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EAP1; HPTTG; PTTG; TUTR1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001282383, the custom clone sequence may differ by one or more nucleotides
ATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCTAAGGATGGGC TGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGTTTTGG CAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGAACTGTCAACAGAGCT ACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGA CTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATT CTTTCCCTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCC TTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCC CTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATTCTGTC GACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATAGATATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282383 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282383.1, NP_001269312.1 |
RefSeq Size | 947 bp |
RefSeq ORF | 609 bp |
Locus ID | 9232 |
UniProt ID | O95997 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Cell cycle, Oocyte meiosis |
Gene Summary | The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Securin产品
Customer
Reviews
Loading...