FAM177A1 (NM_001289022) Human Untagged Clone
CAT#: SC334502
FAM177A1 (untagged) - Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C14orf24 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001289022, the custom clone sequence may differ by one or more nucleotides
ATGGACCAGGAGCCAGTGGGCGGTGTGGAACGAGGAGAAGCCGTCGCAGCCTCGGGAGCTGCGGCCGCCG CGGCATTCGGGGAATCTGCAGGGCAGATGAGTAACGAAAGAGGCTTTGAAAATGTAGAACTGGGAGTCAT AGGAAAAAAGAAGAAAGTCCCAAGGAGAGTCATCCACTTTGTTAGTGGTGAAACAATGGAAGAATATAGC ACAGATGAAGACGAAGTTGATGGCCTGGAGAAGAAAGATGTTTTGCCTACTGTTGATCCGACAAAACTTA CCTGGGGTCCCTACTTATGGTTTTACATGCTTCGGGCTGCTACATCAACTCTCTCAGTGTGTGACTTCCT TGGAGAGAAGATTGCATCTGTTTTGGGTATCAGCACCCCAAAGTACCAATATGCCATTGATGAATATTAT CGGATGAAGAAGGAGGAAGAAGAAGAAGAAGAAGAAAACAGGATGTCTGAAGAAGCAGAAAAACAATATC AACAGAATAAATTGCAGACTGATTCCATTGTTCAGACAGATCAACCAGAGACAGTGATATCCAGCTCATT TGTGAATGTCAATTTTGAAATGGAGGGAGACAGTGAAGTAATTATGGAAAGCAAGCAAAATCCAGTCTCT GTCCCACCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289022 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289022.1, NP_001275951.1 |
RefSeq Size | 2999 bp |
RefSeq ORF | 642 bp |
Locus ID | 283635 |
UniProt ID | Q8N128 |
Gene Summary | This gene encodes a member of a conserved protein family. Alternative splicing results in multiple transcript variants. This gene is thought to be associated with susceptibility to juvenile idiopathic arthritis. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform 2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236608 | FAM177A1 (myc-DDK-tagged) - Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 3 |
CNY 2,400.00 |
|
RG236608 | FAM177A1 (tGFP-tagged) - Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 3 |
CNY 4,370.00 |
其它FAM177A1产品