CLEC12A (NM_001300730) Human Untagged Clone
CAT#: SC334510
CLEC12A (untagged) - Human C-type lectin domain family 12, member A (CLEC12A), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD371; CLL-1; CLL1; DCAL-2; MICL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300730, the custom clone sequence may differ by one or more nucleotides
ATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGAACTCCAGTGAGATGGAAAAAATCCCAGAAA TTGGCAAATTTGGGGAAAAAGCACCTCCAGCTCCCTCTCATGTATGGCGTCCAGCAGCCTTGTTTCTGAC TCTTCTGTGCCTTCTGTTGCTCATTGGATTGGGAGTCTTGGCAAGCATGTTTCACGTAACTTTGAAGATA GAAATGAAAAAAATGAACAAACTACAAAACATCAGTGAAGAGCTCCAGAGAAATATTTCTCTACAACTGA TGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTCCACCACACTGCAAACAATAGCCACCAAATT ATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGTAAGCCTTGTCCAAGGAGATGGATTTGGCAT AAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACATGGCAGGAGAGTAAAATGGCCTGTGCTGCTC AGAATGCCAGCCTGTTGAAGATAAACAACAAAAATGCATTGGAATTTATAAAATCCCAGAGTAGATCATA TGACTATTGGCTGGGATTATCTCCTGAAGAAGATTCCACTCGTGGTATGAGAGTGGATAATATAATCAAC TCCTCTGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300730 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300730.1, NP_001287659.1 |
RefSeq Size | 1573 bp |
RefSeq ORF | 642 bp |
Locus ID | 160364 |
UniProt ID | Q5QGZ9 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011] Transcript Variant: This variant (4) has multiple differences compared to variant 3. These differences result in distinct 5' and 3' UTRs, and cause translation initiation at a downstream start codon, compared to variant 3. The encoded isoform (4) has a shorter N-terminus, and a distinct C-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
其它CLEC12A产品
Customer
Reviews
Loading...