TRAP alpha (SSR1) (NM_001292008) Human Untagged Clone
CAT#: SC334549
SSR1 (untagged) - Human signal sequence receptor, alpha (SSR1), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
SSR1 (TRAP alpha) mouse monoclonal antibody, clone OTI4C7 (formerly 4C7)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TRAPA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001292008, the custom clone sequence may differ by one or more nucleotides
ATGAGACTCCTCCCCCGCTTGCTGCTGCTTCTCTTACTCGTGTTCCCTGCCACTGTCTTGTTCCGAGGCG GCCCCAGAGGCTTGTTAGCAGTGGCACAAGATCTTACAGAGGATGAAGAAACAGTAGAAGATTCCATAAT TGAGGATGAAGATGATGAAGCCGAGGTAGAAGAAGATGAACCCACAGATTTGGTAGAAGATAAAGAGGAA GAAGATGTGTCTGGTGAACCTGAAGCTTCACCGAGTGCAGATACAACTATACTGTTTGTAAAAGGAGAAG AGCCCATGGGCGGACGACCATTTGGTTTGGTCATCAATCTGAACTACAAAGATTTGAACGGCAATGTATT CCAAGATGCAGTCTTCAATCAAACAGTTACAGTTATTGAAAGAGAGGATGGGTTAGATGGAGAAACAATC TTTATGTATATGTTCCTTGCTGGTCTTGGGCTTCTGGTTATTGTTGGCCTTCATCAACTCCTAGAATCTA GAAAGCGTAAGAGACCCATACAGAAAGTAGAAATGGGTACATCAAGTCAGAATGATGTTGACATGAGTTG GATTCCTCAGGAAACATTGAATCAAATCAATAAAGCTTCACCAAGAAGGTTGCCCAGGAAACGGGCACAG AAGAGATCAGTGGGATCTGATGAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001292008 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001292008.1, NP_001278937.1 |
RefSeq Size | 9589 bp |
RefSeq ORF | 657 bp |
Locus ID | 6745 |
UniProt ID | P43307 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1.The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它TRAP alpha产品
Customer
Reviews
Loading...