KCTD17 (NM_001282685) Human Untagged Clone

CAT#: SC334604

KCTD17 (untagged) - Human potassium channel tetramerization domain containing 17 (KCTD17), transcript variant 3



  "NM_001282685" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KCTD17 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282685, the custom clone sequence may differ by one or more nucleotides


ATGCAGACGCCGCGGCCGGCGATGAGGATGGAGGCCGGGGAGGCAGCGCCGCCGGCGGGGGCGGGCGGCC
GCGCCGCAGGCGGCTGGGGCAAGTGGGTGCGGCTCAACGTGGGGGGCACGGTGTTCCTGACCACCCGGCA
GACGCTGTGCCGCGAGCAGAAGTCCTTCCTCAGCCGCCTGTGCCAGGGGGAAGAGCTGCAGTCGGACCGG
GATGAGACCGGGGCCTACCTCATTGACCGTGACCCCACCTACTTCGGGCCCATCCTGAACTTCCTCCGGC
ATGGCAAGCTGGTGCTGGACAAGGACATGGCTGAGGAGGGGGTCCTGGAGGAAGCCGAGTTCTACAACAT
CGGCCCGCTGATCCGCATCATCAAAGACCGGATGGAAGAGAAGGACTACACGGTCACCCAGGTCCCACCC
AAGCACGTGTACCGCGTGCTGCAGTGCCAGGAGGAGGAGCTCACGCAAATGGTCTCCACCATGTCTGATG
GCTGGCGCTTCGAGCAGCTGGTGAACATCGGCTCCTCCTACAACTACGGCAGCGAGGACCAGGCAGAGTT
CCTGTGTGTGGTGTCCAAGGAGCTCCACAGCACCCCAAACGGGCTGAGCTCAGAGTCCAGCCGCAAAACC
AAGGTTCCCGTCCGCACCCTCTCAGACCTGAGGCTGAGCTTGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282685
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282685.1, NP_001269614.1
RefSeq Size 1607 bp
RefSeq ORF 678 bp
Locus ID 79734
UniProt ID Q8N5Z5
Protein Families Ion Channels: Other
Gene Summary This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016]
Transcript Variant: This variant (3) lacks two alternate exons in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 3, which has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...