OBP2A (NM_001293189) Human Untagged Clone

CAT#: SC334623

OBP2A (untagged) - Human odorant binding protein 2A (OBP2A), transcript variant gamma



  "NM_001293189" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-OBP2A Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hOBPIIa; LCN13; OBP; OBP2C; OBPIIa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293189, the custom clone sequence may differ by one or more nucleotides


ATGAAGACCCTGTTCCTGGGTGTCACGCTCGGCCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAGG
ATATCACAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAGGACAGGAGGCCCAG
GAAGGTGTCCCCAGTGAAGGTGACAGCCCTGGGCGGTGGGAACTTGGAAGCCACGTTCACCTTCATGAGG
GAGGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATTCAGCGCCTATG
GGGGCAGGAAGCTCATATACCTGCAGGAGCTGCCCGGGACGGACGACTACGTCTTTTACTGCAAAGACCA
GCGCCGTGGGGGCCTGCGCTACATGGGAAAGCTTGTGGCATCTGCTCCCTGCAGGGCCGTGCCGCTGTCC
CCACCTTGGCTCACCTGGCCACCTCACCTGCAGGTAGGAATCCTAATACCAACCTGGAGGCCCTGGAAGA
ATTTAAGAAATTGGTGCAGCACAAGGGACTCTCGGAGGAGGACATTTTCATGCCCCTGCAGACGGGAAGC
TGCGTTCTCGAACACTAGGCAGCCCCCGGGTCTGCACCTCCAGAGCCCACCCTACCACCAGACACAGAGC
CCGGACCACCTGGACCTACCCTCCAGCCATGACCCTTCCCTGCTCCCACCCACCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001293189
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293189.1, NP_001280118.1
RefSeq Size 754 bp
RefSeq ORF 687 bp
Locus ID 29991
UniProt ID Q9NY56
Protein Families Secreted Protein
Gene Summary This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (gamma, PMID:10607840) represents the longest transcript and encodes the longest isoform (gamma).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...