LRAT (NM_001301645) Human Untagged Clone
CAT#: SC334641
LRAT (untagged) - Human lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) (LRAT), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LCA14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301645, the custom clone sequence may differ by one or more nucleotides
ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGC TCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCG AGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTT GCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCA ACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGC CTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAG GTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACT TCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGAT AATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGC TTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301645 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301645.1, NP_001288574.1 |
RefSeq Size | 4735 bp |
RefSeq ORF | 693 bp |
Locus ID | 9227 |
UniProt ID | O95237 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Retinol metabolism |
Gene Summary | The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236747 | LRAT (myc-DDK-tagged) - Human lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) (LRAT), transcript variant 2 |
CNY 2,400.00 |
|
RG236747 | LRAT (tGFP-tagged) - Human lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) (LRAT), transcript variant 2 |
CNY 4,370.00 |