DYRK4 (NM_001282286) Human Untagged Clone
CAT#: SC334668
DYRK4 (untagged) - Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (DYRK4), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282286, the custom clone sequence may differ by one or more nucleotides
ATGTGGAGCCTGGGCTGCATCACGGCGGAGTTGTACACGGGCTACCCCCTGTTCCCCGGGGAGAATGAGG TGGAGCAGCTGGCCTGCATCATGGAGGTGCTGGGTCTGCCGCCAGCCGGCTTCATTCAGACAGCCTCCAG GAGACAGACATTCTTTGATTCCAAAGGTTTTCCTAAAAATATAACCAACAACAGGGGGAAAAAAAGATAC CCAGATTCCAAGGACCTCACGATGGTGCTGAAAACCTATGACACCAGCTTCCTGGACTTTCTCAGAAGGT GTTTGGTATGGGAACCTTCTCTTCGCATGACCCCGGACCAGGCCCTCAAGCATGCTTGGATTCATCAGTC TCGGAACCTCAAGCCACAGCCCAGGCCCCAGACCCTGAGGAAATCCAATTCCTTTTTCCCCTCTGAGACA AGGAAGGACAAGGTTCAAGGCTGTCATCACTCGAGCAGAAAAGATGAGATCACCAAAGAGACTACAGAGA AAACAAAAGATAGCCCCACGAAGCATGTTCAGCATTCAGGTGATCAGCAGGACTGTCTCCAGCACGGAGC TGACACTGTTCAGCTGCCTCAACTGGTAGACGCTCCCAAGAAGTCAGAGGCAGCTGTCGGGGCGGAGGTG TCCATGACCTCCCCAGGACAGAGCAAAAACTTCTCCCTCAAGAACACAAACGTTTTACCCCCTATTGTAT GA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282286 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282286.1, NP_001269215.1 |
RefSeq Size | 965 bp |
RefSeq ORF | 702 bp |
Locus ID | 8798 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (3) differs in the 5' UTR, represents the use of an alternate promoter which results in translation initiation at a downstream AUG, and uses an alternate in-frame splice site in the 3' terminal exon compared to variant 1. The resulting isoform (3) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236774 | DYRK4 (myc-DDK-tagged) - Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (DYRK4), transcript variant 3 |
CNY 3,990.00 |
|
RG236774 | DYRK4 (tGFP-tagged) - Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (DYRK4), transcript variant 3 |
CNY 4,370.00 |