PPP1R7 (NM_001282411) Human Untagged Clone

CAT#: SC334706

PPP1R7 (untagged) - Human protein phosphatase 1, regulatory subunit 7 (PPP1R7), transcript variant 4



  "NM_001282411" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PPP1R7 mouse monoclonal antibody, clone OTI4F9 (formerly 4F9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SDS22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282411, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGATGGAGGAAGAACATGAGCTGCCTG
TGGACATGGAAACCATCAACCTGGACAGAGATGCAGAGGATGTTGATTTGAATCACTATCGCATAGGGAA
GATTGAAGGATTTGAGGTACTGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAATTAAATGCATT
GAGAATCTGGAGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAAGAAGATTGAGA
ATCTGGAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAACATCGAAGGGGT
TGACAAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCAGTAAAATTGAGAACTTAAGC
AACTTACATCAACTACAGATGCTAGAGCTGGGATCTAACCGCATCCGGGCAATCGAAAATATCGACACCT
TAACCAACCTGGAGAGTTTGTTTTTGGGGAAAAACAAAATTACTAAACTTCAGAACCTGGATGCGCTCAC
CAACCTGACAGTCCTCAGTATGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGAACCTGGTGAAC
CTGCGGGAGCTGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAATGTGCAGGACA
GCCTCACGTACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282411
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282411.1, NP_001269340.1
RefSeq Size 1674 bp
RefSeq ORF 714 bp
Locus ID 5510
UniProt ID Q15435
Protein Families Druggable Genome, Phosphatase
Gene Summary This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (4) lacks alternate exons in the coding region and uses an alternate 3' terminal exon compared to variant 1. The encoded protein (isoform 4, also known as sds22beta2) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...