KIR2DS4 (NM_001281971) Human Untagged Clone

CAT#: SC334732

KIR2DS4 (untagged) - Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4), transcript variant 2 (KIR2DS4*003 allele)



  "NM_001281971" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KIR2DS4 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD158I; KIR-2DS4; KIR1D; KIR412; KKA3; NKAT-8; NKAT8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281971, the custom clone sequence may differ by one or more nucleotides


ATGTCGCTCATGGTCATCATCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACAGGAGG
GAGTCCACAGAAAACCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGAGACAGTCATCCT
GCAATGTTGGTCGGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAACAACACTTTG
CACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCC
TTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCC
TCTGGACATGGTGATCATAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCAG
GCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCT
CCCTGCAGTGCGCAGCATCAACGGAACATTCCAGGCCGACTTTCCTCTGGGCCCTGCCACCCACGGAGGG
ACCTACAGATGCTTCGGCTCTTTCCGTGACGCTCCCTACGAGTGGTCAAACTCGAGTGATCCACTGCTTG
TTTCCGTCACAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAACCC
CAGACACCTACATGTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281971
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281971.1, NP_001268900.1
RefSeq Size 1608 bp
RefSeq ORF 720 bp
Locus ID 3809
UniProt ID P43632
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Natural killer cell mediated cytotoxicity
Gene Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) represents the 22nt deletion allele KIR2DS4*003 which results in a frameshift and loss of the C-terminal membrane binding domain. The resulting protein (isoform 2) has a distinct C-teminus and is likely secreted. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...