ZNF187 (ZSCAN26) (NM_001287422) Human Untagged Clone

CAT#: SC334953

ZSCAN26 (untagged) - Human zinc finger and SCAN domain containing 26 (ZSCAN26), transcript variant e



  "NM_001287422" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-ZNF187 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SRE-ZBP; SREZBP; ZNF187
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287422, the custom clone sequence may differ by one or more nucleotides


ATGGAGGCTCATAATGAGGGCTCTAACTTGGAAAGGCATCAGGCCAAGCCCAAAGAGAAGATTGAGTATA
AATGCTCAGAACGTGAGCAGAGATTCATCCAGCACTTGGACCTGATTGAACATGCGAGTACACACACGGG
AAAGAAACTCTGCGAGTCTGATGTGTGTCAGAGTTCCAGTCTTACAGGACATAAGAAAGTCCTCTCTAGA
GAGAAAGGTCATCAGTGTCATGAGTGTGGGAAAGCCTTTCAGAGGAGTTCACACCTCGTCAGACATCAGA
AAATCCATCTTGGTGAGAAGCCTTATCAGTGCAATGAGTGTGGCAAAGTCTTTAGCCAGAATGCAGGCCT
TTTGGAACATCTCAGAATTCATACTGGAGAGAAACCTTATCTATGTATCCATTGTGGAAAAAATTTTAGG
CGCAGCTCTCACCTTAATCGACATCAGAGAATTCACAGTCAGGAGGAGCCCTGTGAGTGCAAGGAGTGTG
GAAAAACCTTTAGTCAGGCCTTACTCCTCACCCACCATCAGAGAATCCATAGTCACTCCAAAAGCCATCA
ATGTAACGAGTGTGGAAAAGCTTTCAGTTTGACCTCAGACCTTATTCGACACCACAGAATTCATACTGGA
GAAAAACCTTTCAAGTGTAACATATGCCAGAAAGCCTTCCGACTAAACTCACACCTTGCTCAGCATGTAA
GAATCCACAATGAAGAAAAACCCTATCAGTGTAGTGAATGTGGAGAAGCCTTCAGGCAAAGGTCAGGTCT
TTTTCAACATCAGAGATATCACCACAAAGACAAACTGGCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287422
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287422.1, NP_001274351.1
RefSeq Size 2246 bp
RefSeq ORF 813 bp
Locus ID 7741
UniProt ID Q16670
Protein Families Transcription Factors
Gene Summary May be involved in transcriptional regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (e) lacks two exons in the 5' coding region and initiates translation at a downstream start codon, compared to variant a. It encodes isoform d, which is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...