PITPNB (NM_001284278) Human Untagged Clone

CAT#: SC334972

PITPNB (untagged) - Human phosphatidylinositol transfer protein, beta (PITPNB), transcript variant sp3



  "NM_001284278" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PITPNB mouse monoclonal antibody,clone OTI6H10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PI-TP-beta; PtdInsTP; VIB1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284278, the custom clone sequence may differ by one or more nucleotides


ATGGGAGATTTGTTGATGGAGAAGTGCCGTGTGGTTTTGCCATGTTCTGTTCAGGAGTATCAGGTTGGGC
AGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAGAA
TGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACGCACAAAATTTATCACCTAAAGAGCAAAGTG
CCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTGTTTCATGAGAAAGCCTGGAATGCGTACC
CCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATCGAAACATGGCA
CAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTTGAAATT
GTCCATATAGATATTGCAGATAGAAGTCAAGTTGAACCAGCAGACTACAAAGCTGATGAAGACCCAGCAT
TATTCCAGTCAGTCAAGACCAAGAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCAAACAGCCC
TGACTGTCCCCAGATGTGTGCCTATAAGCTGGTGACCATCAAATTCAAGTGGTGGGGACTGCAAAGCAAA
GTAGAAAACTTCATTCAAAAGCAAGAAAAACGGATATTTACAAACTTCCATCGCCAGCTTTTTTGTTGGA
TTGACAAGTGGATCGATCTCACGATGGAAGACATTAGGAGAATGGAAGACGAGACTCAGAAAGAACTAGA
AACAATGCGTAAGAGGGGTTCCGTTCGAGGCACGTCGGCTGCTGATGTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001284278
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284278.1, NP_001271207.1
RefSeq Size 2959 bp
RefSeq ORF 822 bp
Locus ID 23760
UniProt ID P48739
Gene Summary This gene encodes a cytoplasmic protein that catalyzes the transfer of phosphatidylinositol and phosphatidylcholine between membranes. This transfer activity is required for COPI complex-mediated retrograde transport from the Golgi apparatus to the endoplasmic reticulum. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (sp3) uses an alternate 5' terminal exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant sp1. The encoded isoform (3) has a distinct N-terminus and is 2 aa longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...