RNF36 (TRIM69) (NM_001301145) Human Untagged Clone

CAT#: SC335022

TRIM69 (untagged) - Human tripartite motif containing 69 (TRIM69), transcript variant d



  "NM_001301145" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TRIM69 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSD-34; HSD34; RNF36; Trif
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301145, the custom clone sequence may differ by one or more nucleotides


ATGGAGTTTCTAAAGCTGCATCAGTTCCTGCACAGCAAAGAAAAGGACATTTTAACTGAGCTCCGGGAAG
AGGGGAAAGCCTTGAATGAGGAGATGGAGTTGAATCTGAGCCAGCTTCAGGAGCAATGTCTCTTAGCCAA
GGATATGTTGGACATCACAACTCTCTTACATAGCTTGGAGCAAGGAATGAAGGTGCTGGCAACCAGAGAG
CTTATTTCCAGAAAGCTGAACCTGGGCCAGTACAAAGGTCCTATCCAGTACATGGTATGGAGGGAAATGC
AGGACACTCTCTGCCCAGGCCTGTCTCCACTAACTCTGGACCCTAAAACAGCTCACCCAAATCTGGTGCT
CTCCAAAAGCCAAACCAGCGTCTGGCATGGTGACATTAAGAAGATAATGCCTGATGATCCTGAGAGGTTT
GACTCAAGTGTGGCTGTACTGGGCTCAAGAGGCTTCACCTCTGGAAAGTGGTACTGGGAAGTAGAAGTAG
CAAAGAAGACAAAATGGACAGTTGGAGTTGTCAGAGAATCCATCATTCGGAAGGGCAGCTGTCCTCTAAC
TCCTGAGCAAGGATTCTGGCTTTTAAGACTAAGGAACCAAACTGATCTAAAGGCTCTGGATTTGCCTTCT
TTCAGTCTGACACTGACTAACAACCTCGACAAGGTGGGCATATACCTGGATTATGAAGGAGGACAGTTGT
CCTTCTACAATGCTAAAACCATGACTCACATTTACACCTTCAGTAACACTTTCATGGAGAAACTTTATCC
CTACTTCTGCCCCTGCCTTAATGATGGTGGAGAGAATAAAGAACCATTGCACATCTTACATCCACAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301145
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301145.1, NP_001288074.1
RefSeq Size 1394 bp
RefSeq ORF 840 bp
Locus ID 140691
UniProt ID Q86WT6
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (d) lacks an alternate exon and uses two alternate splice sites, and it thus differs in its 5' UTR, initiates translation at a downstream in-frame start codon, and lacks an in-frame segment in the central coding region, compared to variant a. The encoded isoform (d, also known as TRIMLESS beta) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...