DACT2 (NM_001286351) Human Untagged Clone

CAT#: SC335037

DACT2 (untagged) - Human dishevelled-binding antagonist of beta-catenin 2 (DACT2), transcript variant 3



  "NM_001286351" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Dact2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA503C24.7; C6orf116; DAPPER2; DPR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286351, the custom clone sequence may differ by one or more nucleotides


ATGTGGACGCCGGGCGGACCCCCGGGGTCCGCGGGCTGGGACCGCCGTAGGTTGGGCGCGAGGTTGCGCG
CGGCGTTCGCGGGGCTGCAGGAGCTGCAGGGGCTGCGAGCCACGCAGCAGGAGCGGGTACGGGGCGCCCT
GGCCCTGCAGCCCCCGCCCGCGCCCGCCGCGCCCTGCGGCCCCCACGGCCTCCACGGCCCCGAGCAGCAG
CTGGAGGCGGCGCTGGCCGCGCTGCAGGAGCAGCTGTCCCGGCTGAGACAACAGGACATCGGCCTGAAGA
CCCACCTGGACCAGCTGGACCTGCAGATTAGCAAGCTGCAGCTGGATGTGGGCACAGCCTCAGGGGAGGC
CCTGGACAGCGACAGCAGGCCCAGCTCAGGCTTTTACGAGATGAGCGACGGTGGATCCTGCTCCCTGTCC
ACGTCCTGTGCCTCCGTCTGCAGTGACCACATCTCTCCCTCGCTGGGCAGTTTGTTGCCTGTGGCCCAGG
CCCACAAGGCCAGGCCCAGCATGGGGGACTGGAGGCCCCGGTCGGTTGATGAGACTACTGTGCCAGCGTG
GAGACCCCAGGCTACCGAGGAGGGCGCCAGGCCCCCAGGGAGCGTGGAGGATGCAGGCCAGCCGTGGGGC
ACATTCTGGCCCAGGCCTGTGTCTACAGAGCTGTGCAATGCTCCAGGTGAACTTGACATGCATGCTCCGC
CTGCAGGCTGCACCTCCAGTTCACTGACAGGTGTAGGTTCTGGTTTGAGAGGAAAGTGTGGCCTCTGTGG
CTGTCAGCTCCCTTTCTGCTCAGTGAACACAAGTTCAAAGACAAAATCATCAGGAATTTCAAGACAGCAA
TGA


Restriction Sites SgfI-MluI     
ACCN NM_001286351
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286351.1, NP_001273280.1
RefSeq Size 2043 bp
RefSeq ORF 843 bp
Locus ID 168002
UniProt ID Q5SW24
Gene Summary Involved in regulation of intracellular signaling pathways during development. Negatively regulates the Nodal signaling pathway, possibly by promoting the lysosomal degradation of Nodal receptors, such as TGFBR1. May be involved in control of the morphogenetic behavior of kidney ureteric bud cells by keeping cells epithelial and restraining their mesenchymal character. May play an inhibitory role in the re-epithelialization of skin wounds by attenuating TGF-beta signaling (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains alternate 3' exon structure and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...