EB3 (MAPRE3) (NM_001303050) Human Untagged Clone
CAT#: SC335038
MAPRE3 (untagged) - Human microtubule-associated protein, RP/EB family, member 3 (MAPRE3), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EB3; EBF3; EBF3-S; RP3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001303050, the custom clone sequence may differ by one or more nucleotides
ATGGCCGTCAATGTGTACTCCACATCTGTGACCAGTGAAAATCTGAGTCGCCATGATATGCTTGCATGGG TCAACGACTCCCTGCACCTCAACTATACCAAGATAGAACAGCTTTGTTCAGGGGCAGCCTACTGCCAGTT CATGGACATGCTCTTCCCCGGCTGTGTGCACTTGAGGAAAGTGAAGTTCCAGGCCAAACTAGAGCACGAA TACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAAAATCATTCCTGTAG AGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTAAGAAATTCTTTGACGC AAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAGCGCCACCTCCTAAC CCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCACAGAGGACGTCCCCCA CAGGCCCAAAAAACATGCAGACCTCTGGCCGGCTGAGCAATGTGGCCCCCCCCTGCATTCTCCGGAAGAA TCCTCCATCAGCCCGAAATGGCGGCCATGAGACTGATGCCCAAATTCTTGAACTCAACCAACAGCTGGTG GACTTGAAGCTGACAGTGGATGGGCTGGAGAAGGAACGTGACTTCTACTTCAGCAAACTTCGTGACATCG AGCTCATCTGCCAGGAGCATGAAAGTGAAAACAGCCCTGTTATCTCAGGCATCATTGGCATCCTCTATGC CACAGAGGAAGGATTCGCACCCCCTGAGGACGATGAGATTGAAGAGCATCAACAAGAAGACCAGGACGAG TACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303050 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001303050.1, NP_001289979.1 |
RefSeq Size | 1965 bp |
RefSeq ORF | 846 bp |
Locus ID | 22924 |
UniProt ID | Q9UPY8 |
Gene Summary | The protein encoded by this gene is a member of the RP/EB family of genes. The protein localizes to the cytoplasmic microtubule network and binds APCL, a homolog of the adenomatous polyposis coli tumor suppressor gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237144 | MAPRE3 (myc-DDK-tagged) - Human microtubule-associated protein, RP/EB family, member 3 (MAPRE3), transcript variant 2 |
CNY 3,990.00 |
|
RG237144 | MAPRE3 (tGFP-tagged) - Human microtubule-associated protein, RP/EB family, member 3 (MAPRE3), transcript variant 2 |
CNY 4,370.00 |