GABRP (NM_001291985) Human Untagged Clone

CAT#: SC335121

GABRP (untagged) - Human gamma-aminobutyric acid (GABA) A receptor, pi (GABRP), transcript variant 2



  "NM_001291985" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GABRP Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291985, the custom clone sequence may differ by one or more nucleotides


ATGAACTACAGCCTCCACTTGGCCTTCGTGTGTCTGAGTCTCTTCACTGAGAGGATGTGCATCCAGGGGA
GTCAGTTCAACGTCGAGGTCGGCAGAAGTGACAAGCTTTCCCTGCCTGGCTTTGAGAACCTCACAGCAGG
ATATAACAAATTTCTCAGGCCCAATTTTGGTGGAGAACCCGTACAGATAGCGCTGACTCTGGACATTGCA
AGTATCTCTAGCATTTCAGAGAGTAACATGGACTACACAGCCACCATATACCTCCGACAGCGCTGGATGG
ACCAGCGGCTGGTGTTTGAAGGCAACAAGAGCTTCACTCTGGATGCCCGCCTCGTGGAGTTCCTCTGGGT
GCCAGATACTTACATTGTGGAGTCCAAGAAGTCCTTCCTCCATGAAGTCACTGTGGGAAACAGGCTCATC
CGCCTCTTCTCCAATGGCACGGTCCTGTATGCCCTCAGAATCACGACAACTGTTGCATGTAACATGGATC
TGTCTAAATACCCCATGGACACACAGACATGCAAGTTGCAGCTGGAAAGCTGGGGCTATGATGGAAATGA
TGTGGAGTTCACCTGGCTGAGAGGGAACGACTCTGTGCGTGGACTGGAACACCTGCGGCTTGCTCAGTAC
ACCATAGAGCGGTATTTCACCTTAGTCACCAGATCGCAGCAGGAGACAGGAAATTACACTAGATTGGTCT
TACAGTTTGAGCTTCGGAGGAATGTTCTGTATTTCATTTTGGAAACCTACGTTCCTTCCACTTTCCTGGT
GGTGTTGTCCTGGGTTTCATTTTGGATCTCTCTCGATTCAGTCCCTGCAAGAACCTGCATTGGGGACAAC
AAAGGAAGTAGAAGAAGTCAGTATTACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001291985
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291985.1, NP_001278914.1
RefSeq Size 3137 bp
RefSeq ORF 870 bp
Locus ID 2568
UniProt ID O00591
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) lacks the penultimate exon, which causes a frameshift, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...