KRT85 (NM_001300810) Human Untagged Clone

CAT#: SC335156

KRT85 (untagged) - Human keratin 85 (KRT85), transcript variant 2



  "NM_001300810" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-KRT85 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ECTD4; Hb-5; HB5; hHb5; K85; KRTHB5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335156 representing NM_001300810.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTATTCAAGGTCCAGTTTCTCAGCTCCAGACCTTCTCTCTCCCACACCCAGGACGTGGACTGTGCC
TACCTGCGGAAATCAGACCTGGAGGCCAATGTGGAGGCCCTGGTGGAGGAGTCTAGCTTCCTGAGGCGC
CTCTATGAAGAGGAGATCCGCGTTCTCCAAGCCCACATCTCAGACACCTCGGTCATAGTCAAGATGGAC
AACAGCCGAGACCTGAACATGGACTGCATCATCGCTGAGATCAAGGCTCAGTATGACGATGTTGCCAGC
CGCAGCCGGGCCGAGGCTGAGTCCTGGTACCGTAGCAAGTGTGAGGAGATGAAGGCCACGGTGATCAGG
CATGGGGAGACCCTGCGCCGCACCAAGGAGGAGATCAACGAGCTGAACCGCATGATCCAGAGGCTGACG
GCCGAGATTGAGAATGCCAAGTGCCAGCGTGCCAAGCTGGAGGCTGCTGTGGCTGAGGCAGAGCAGCAG
GGTGAGGCGGCCCTCAGCGATGCCCGCTGCAAGCTGGCTGAGCTGGAGGGCGCCCTGCAGAAGGCCAAG
CAGGACATGGCCTGCCTGCTCAAGGAGTACCAGGAGGTGATGAACTCCAAGCTGGGCCTGGACATCGAG
ATCGCCACCTACAGGCGCCTGCTGGAGGGCGAGGAACACAGGCTGTGTGAAGGTGTGGGCTCTGTGAAT
GTCTGTGTCAGCAGCTCCCGTGGTGGAGTCTCCTGTGGGGGCCTCTCCTACAGCACCACCCCAGGGCGC
CAGATCACTTCTGGCCCCTCAGCCATAGGCGGCAGCATCACGGTGGTGGCCCCTGACTCCTGTGCCCCC
TGCCAGCCTCGTTCCTCCAGCTTCAGCTGCGGGAGTAGCCGGTCGGTCCGCTTTGCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001300810
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001300810.1
RefSeq Size 1937 bp
RefSeq ORF 888 bp
Locus ID 3891
UniProt ID P78386
MW 32.5 kDa
Gene Summary The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus, and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...