PGAP3 (NM_001291728) Human Untagged Clone

CAT#: SC335192

PGAP3 (untagged) - Human post-GPI attachment to proteins 3 (PGAP3), transcript variant 3



  "NM_001291728" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PGAP3 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGLA546; CAB2; hCOS16; PERLD1; PP1498
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335192 representing NM_001291728.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGGCCTGGCGGCGCGGTTGGTCCTGCTAGCTGGGGCAGCGGCGCTGGCGAGCGGCTCCCAGGGC
GACCGTGAGCCGGTGTACCGCGACTGCGTACTGCAGTGCGAAGAGCAGAACTGCTCTGGGGGCGCTCTG
AATCACTTCCGCTCCCGCCAGCCAATCTACATGAGTCTAGCAGGCTGGACCTGTCGGGACGACTGTAAG
TATGAGTGTATGTGGGTCACCGTTGGGCTCTACCTCCAGGAAGGTCACAAAGTGCCTCAGTTCCATGGC
AAGTGGCCCTTCTCCCGGTTCCTGTTCTTTCAAGAGCCGGCATCGGCCGTGGCCTCGTTTCTCAATGGC
CTGGCCAGCCTGGTGATGCTCTGCCGCTACCGCACCTTCGTGCCAGCCTCCTCCCCCATGTACCACACC
TGTGTGGCCTTCGCCTGGAAAATGGACTACTTCTGTGCCTCCACTGTCATCCTACACTCAATCTACCTG
TGCTGCGTCAGGACCGTGGGGCTGCAGCACCCAGCTGTGGTCAGTGCCTTCCGGGCTCTCCTGCTGCTC
ATGCTGACCGTGCACGTCTCCTACCTGAGCCTCATCCGCTTCGACTATGGCTACAACCTGGTGGCCAAC
GTGGCTATTGGCCTGGTCAACGTGGTGTGGTGGCTGGCCTGGTGCCTGTGGAACCAGCGGCGGCTGCCT
CACGTGCGCAAGTGCGTGGTGGTGGTCTTGCTGCTGCAGGGGCTGTCCCTGCTCGAGCTGCTTGACTTC
CCACCGCTCTTCTGGGTCCTGGATGCCCATGCCATCTGGCACATCAGCACCATCCCTGTCCACGTCCTC
TTTTTCAGCTTTCTGGAAGATGACAGCCTGTACCTGCTGAAGGAATCAGAGGACAAGTTCAAGCTGGAC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291728
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291728.1
RefSeq Size 2658 bp
RefSeq ORF 900 bp
Locus ID 93210
UniProt ID Q96FM1
Protein Families Transmembrane
MW 34 kDa
Gene Summary This gene encodes a glycosylphosphatidylinositol (GPI)-specific phospholipase that primarily localizes to the Golgi apparatus. This ubiquitously expressed gene is predicted to encode a seven-transmembrane protein that removes unsaturated fatty acids from the sn-2 position of GPI. The remodeling of the constituent fatty acids on GPI is thought to be important for the proper association between GPI-anchored proteins and lipid rafts. The tethering of proteins to plasma membranes via posttranslational GPI-anchoring is thought to play a role in protein sorting and trafficking. Mutations in this gene cause an autosomal recessive form of neurologic hyperphosphatasia with cognitive disability (HPMRS4). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (3) lacks an in-frame exon in the 3' coding region, compared to variant 1. It encodes a shorter protein (isoform 3), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...