ADA2a (TADA2A) (NM_001291918) Human Untagged Clone

CAT#: SC335224

TADA2A (untagged) - Human transcriptional adaptor 2A (TADA2A), transcript variant 4



  "NM_001291918" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TADA2A rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADA2; ADA2A; hADA2; KL04P; TADA2L
Vector pCMV6-Entry
Sequence Data
>SC335224 representing NM_001291918.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCGTTTGGGTTCCTTTAGCAATGATCCCTCTGATAAGCCACCTTGCCGAGGCTGCTCCTCCTAC
CTCATGGAGCCTTATATCAAGTGTGCTGAATGTGGGCCACCTCCTTTTTTCCTCTGCTTGCAGTGTTTC
ACTCGAGGCTTTGAGTACAAGAAACATCAAAGCGATCATACTTATGAAATAATGACTTCAGATTTTCCT
GTCCTTGATCCCAGCTGGACTGCTCAAGAAGAAATGGCCCTTTTAGAAGCTGTGATGGACTGTGGCTTT
GGAAATTGGCAGGATGTAGCCAATCAAATGTGCACCAAGACCAAGGAGGAGTGTGAGAAGCACTATATG
AAGCATTTCATCAATAACCCTCTGTTTGCATCTACCCTGCTGAACCTGAAACAAGCAGAGGAAGCAAAA
ACTGCTGACACAGCCATTCCATTTCACTCTACAGATGACCCTCCCCGACCTACCTTTGACTCCTTGCTT
TCTCGGGACATGGCCGGGTACATGCCAGCTCGAGCAGATTTCATTGAGGAATTTGACAATTATGCAGAA
TGGGACTTGAGAGACATTGATTTTGTTGAAGATGACTCGGACATTTTACATGCTCTGAAGATGGCTGTG
GTAGATATCTATCATTCCAGGTTAAAGGAGAGACAAAGACGAAAAAAAATTATAAGAGACCATGGATTA
ATCAACCTTAGAAAGTTTCAATTAATGGAACGGCGGTATCCCAAGGAGGTCCAGGACCTGTATGAAACA
ATGAGGCGATTTGCAAGAATTGTGGGGCCAGTGGAACATGACAAATTCATTGAAAGCCATGCATGTAGG
TGGTTTTTGAGCCTTGAGCAGTATTTGTGTGTGTATATTTATATAAATAGGAGAGATAATGGTGTGTTT
TATGTGAAGTTCTATAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001291918
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291918.1
RefSeq Size 1119 bp
RefSeq ORF 918 bp
Locus ID 6871
UniProt ID O75478
Protein Families Transcription Factors
MW 36 kDa
Gene Summary Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (4) differs in the 5' UTR and represents an alternate transcript termination and polyadenylation site compared to variant 1. This results in a shorter isoform (b) which has a distinct C-terminus compared to isoform a. Variants 2 and 4 both encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...