Retinoid X Receptor alpha (RXRA) (NM_001291921) Human Untagged Clone

CAT#: SC335633

RXRA (untagged) - Human retinoid X receptor, alpha (RXRA), transcript variant 3



  "NM_001291921" in other vectors (2)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RXRA Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NR2B1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335633 representing NM_001291921.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACCCCGTCAGCAGCAGCGAGGACATCAAGCCCCCCCTGGGCCTCAATGGCGTCCTCAAGGTCCCC
GCCCACCCCTCAGGAAACATGGCTTCCTTCACCAAGCACATCTGCGCCATCTGCGGGGACCGCTCCTCA
GGCAAGCACTATGGAGTGTACAGCTGCGAGGGGTGCAAGGGCTTCTTCAAGCGGACGGTGCGCAAGGAC
CTGACCTACACCTGCCGCGACAACAAGGACTGCCTGATTGACAAGCGGCAGCGGAACCGGTGCCAGTAC
TGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAAGCCGTGCAGGAGGAGCGGCAGCGTGGC
AAGGACCGGAACGAGAATGAGGTGGAGTCGACCAGCAGCGCCAACGAGGACATGCCGGTGGAGAGGATC
CTGGAGGCTGAGCTGGCCGTGGAGCCCAAGACCGAGACCTACGTGGAGGCAAACATGGGGCTGAACCCC
AGCTCGCCGAACGACCCTGTCACCAACATTTGCCAAGCAGCCGACAAACAGCTTTTCACCCTGGTGGAG
TGGGCCAAGCGGATCCCACACTTCTCAGAGCTGCCCCTGGACGACCAGGTCATCCTGCTGCGGGCAGGC
TGGAATGAGCTGCTCATCGCCTCCTTCTCCCACCGCTCCATCGCCGTGAAGGACGGGATCCTCCTGGCC
ACCGGGCTGCACGTCCACCGGAACAGCGCCCACAGCGCAGGGGTGGGCGCCATCTTTGACAGGGTGCTG
ACGGAGCTTGTGTCCAAGATGCGGGACATGCAGATGGACAAGACGGAGCTGGGCTGCCTGCGCGCCATC
GTCCTCTTTAACCCTGACTCCAAGGGGCTCTCGAACCCGGCCGAGGTGGAGGCGCTGAGGGAGAAGGTC
TATGCGTCCTTGGAGGCCTACTGCAAGCACAAGTACCCAGAGCAGCCGGGAAGGTTCGCTAAGCTCTTG
CTCCGCCTGCCGGCTCTGCGCTCCATCGGGCTCAAATGCCTGGAACATCTCTTCTTCTTCAAGCTCATC
GGGGACACACCCATTGACACCTTCCTTATGGAGATGCTGGAGGCGCCGCACCAAATGACTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291921
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291921.1
RefSeq Size 5993 bp
RefSeq ORF 1098 bp
Locus ID 6256
UniProt ID P19793
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, Non-small cell lung cancer, Pathways in cancer, PPAR signaling pathway, Small cell lung cancer, Thyroid cancer
MW 41.1 kDa
Gene Summary Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) contains an alternate 5' terminal exon, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Retinoid X Receptor alpha产品

Customer Reviews 
Loading...