MDMX (MDM4) (NM_001278517) Human Untagged Clone

CAT#: SC335828

MDM4 (untagged) - Human MDM4, p53 regulator (MDM4), transcript variant 5



  "NM_001278517" in other vectors (2)

CNY 3,710.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MDM4 (MDMX) mouse monoclonal antibody, clone OTI4B5 (formerly 4B5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BMFS6; HDMX; MDMX; MRP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335828 representing NM_001278517.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAA
ATCAATCAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCAGAGGAAAGTTCC
ACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCATACAT
TCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGACCTTGGATTT
GAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGCAACTATACACCTAGA
AGTAATGGCTCAACTGATTTACAGACAAATCAGGATGTGGGTACTGCCATTGTTTCAGATACTACAGAT
GACTTGTGGTTTTTGAATGAGTCAGTATCAGAGCAGTTAGGTGTTGGAATAAAAGTTGAAGCTGCTGAT
ACTGAACAAACAAGTGAAGAAGTAGGGAAAGTAAGTGACAAAAAGGTGATTGAAGTGGGAAAAAATGAT
GACCTGGAGGACTCTAAGTCCTTAAGTGATGATACCGATGTAGAGGTTACCTCTGAGGATGAGTGGCAG
TGTACTGAATGCAAGAAATTTAACTCTCCAAGCAAGAGGTACTGTTTTCGTTGTTGGGCCTTGAGGAAG
GATTGGTATTCAGATTGTTCAAAGTTAACCCATTCTCTCTCCACGTCTGATATCACTGCCATACCTGAA
AAGGAAAATGAAGGAAATGATGTCCCTGATTGTCGAAGAACCATTTCGGCTCCTGTCGTTAGACCTAAA
GATGCGTATATAAAGAAAGAAAACTCCAAACTTTTTGATCCCTGCAACTCAGTGGAATTCTTGGATTTG
GCTCACAGTTCTGAAAGCCAAGAGACCATCTCAAGCATGGGAGAACAGTTAGATAACCTTTCTGAACAG
AGAACAGATACAGAAAACATGGAGGATTGCCAGAATCTCTTGAAGCCATGTAGCTTATGTGAGAAAAGA
CCACGAGACGGGAACATTATTCATGGAAGGACGGGCCATCTTGTCACTTGTTTTCACTGTGCCAGAAGA
CTAAAGAAGGCTGGGGCTTCATGCCCTATTTGCAAGAAAGAGATTCAGCTGGTTATTAAGGTTTTTATA
GCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278517
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278517.1
RefSeq Size 9796 bp
RefSeq ORF 1179 bp
Locus ID 4194
UniProt ID O15151
Protein Families Druggable Genome, Transcription Factors
Protein Pathways p53 signaling pathway
MW 44 kDa
Gene Summary This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (5, also known as MDM4-G or HDMX-G) lacks three consecutive exons and part of the fourth compared to variant 1. The resulting isoform (5) has the same N- and C-termini but lacks a large internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...