VRK2 (NM_001288838) Human Untagged Clone

CAT#: SC335849

VRK2 (untagged) - Human vaccinia related kinase 2 (VRK2), transcript variant 9



  "NM_001288838" in other vectors (2)

CNY 3,800.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
VRK2 mouse monoclonal antibody,clone OTI2F5
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC335849 representing NM_001288838.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCACCAAAAAGAAATGAAAAATACAAACTTCCTATTCCATTTCCAGAAGGCAAGGTTCTGGATGAT
ATGGAAGGCAATCAGTGGGTACTGGGCAAGAAGATTGGCTCTGGAGGATTTGGATTGATATATTTAGCT
TTCCCCACAAATAAACCAGAGAAAGATGCAAGACATGTAGTAAAAGTGGAATATCAAGAAAATGGCCCG
TTATTTTCAGAACTTAAATTTTATCAGAGAGTTGCAAAAAAAGACTGTATCAAAAAGTGGATAGAACGC
AAACAACTTGATTATTTAGGAATTCCTCTGTTTTATGGATCTGGTCTGACTGAATTCAAGGGAAGAAGT
TACAGATTTATGGTAATGGAAAGACTAGGAATAGATTTACAGAAGATCTCAGGCCAGAATGGTACCTTT
AAAAAGTCAACTGTCCTGCAATTAGGTATCCGAATGTTGGATGTACTGGAATATATACATGAAAATGAA
TATGTTCATGGTGATATAAAAGCAGCAAATCTACTTTTGGGTTACAAAAATCCAGACCAGGTTTATCTT
GCAGATTATGGACTTTCCTACAGATATTGTCCCAATGGGAACCACAAACAGTATCAGGAAAATCCTAGA
AAAGGCCATAATGGGACAATAGAGTTTACCAGCTTGGATGCCCACAAGGGAGTAGCCTTGTCCAGACGA
AGTGACGTTGAGATCCTCGGCTACTGCATGCTGCGGTGGTTGTGTGGGAAACTTCCCTGGGAACAGAAC
CTGAAGGACCCTGTGGCTGTGCAGACTGCTAAAACAAATCTGTTGGACGAGCTCCCCCAGTCAGTGCTT
AAATGGGCTCCTTCTGGAAGCAGTTGCTGTGAAATAGCCCAATTTTTGGTATGTGCTCATAGTTTAGCA
TATGATGAAAAGCCAAACTATCAAGCCCTCAAGAAAATTTTGAACCCTCATGGAATACCTTTAGGACCA
CTGGACTTTTCCACAAAAGGACAGAGTATAAATGTCCATACTCCAAACAGTCAAAAAGTTGATTCACAA
AAGGCTGCAACAAAGCAAGTCAACAAGGCACACAATAGGTTAATCGAAAAAAAAGTCCACAGTGAGAGA
AGCGCTGAGTCCTGTGCAACATGGAAAGTGCAGAAAGAGGAGAAACTGATTGGATTGATGAACAATGAA
GCAGCTCAGTTTAGGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001288838
Insert Size 1191 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288838.1
RefSeq Size 2430 bp
RefSeq ORF 1191 bp
Locus ID 7444
UniProt ID Q86Y07
Protein Families Druggable Genome, Protein Kinase, Transmembrane
MW 45 kDa
Gene Summary This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (9) represents use of an alternate upstream promoter, differs in the 5' UTR, and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1. Variants 5 and 9 encode the same isoform (3, also known as VRK2B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...