Neuro D4 (DPF1) (NM_001289978) Human Untagged Clone

CAT#: SC336042

DPF1 (untagged) - Human D4, zinc and double PHD fingers family 1 (DPF1), transcript variant 4



  "NM_001289978" in other vectors (2)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Anti-Neuro-d4 / DPF1 Antibody
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAF45b; NEUD4; neuro-d4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336042 representing NM_001289978.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGGCCTCAGCGCCCGCCCGACCGCTGGGAGGACCGACCCGGCGGGGACCTGCTGGGGGCAGGAC
CCGGGGAGCAAGATGGCCACTGTCATCCCTGGCCCCCTGAGCCTAGGCGAGGACTTCTACCGCGAGGCC
ATCGAGCACTGCCGCAGTTACAACGCGCGCCTGTGCGCCGAGCGCAGCCTGCGACTGCCCTTCCTCGAC
TCGCAGACCGGCGTGGCCCAGAACAACTGCTACATCTGGATGGAGAAGACCCACCGCGGGCCGGGTTTG
GCCCCGGGACAGATTTACACGTACCCCGCCCGCTGTTGGAGGAAGAAACGGAGACTCAACATCCTGGAG
GACCCCAGACTCAGGCCCTGCGAGTACAAGATCGACTGTGAAGCACCCCTGAAGAAGGAGGGTGGCCTC
CCGGAAGGGCCGGTCCTCGAGGCTCTACTGTGTGCAGAGACGGGGGAGAAGAAGATTGAGCTGAAGGAG
GAGGAGACCATTATGGACTGTCAGAAACAGCAGTTGCTGGAGTTTCCGCATGACCTCGAGGTGGAAGAC
TTGGAGGATGACATTCCCAGGAGGAAGAACAGGGCCAAAGGAAAGGCATATGGCATCGGGGGTCTCCGG
AAACGCCAGGACACCGCTTCCCTGGAGGACCGAGACAAGCCGTATGTCTGTGATATCTGTGGGAAACGG
TATAAGAACCGGCCGGGGCTCAGCTACCACTACACCCACACCCACCTGGCCGAGGAGGAGGGGGAGGAG
AACGCCGAACGCCACGCCCTGCCCTTCCACCGGAAAAACAACCATAAACAGTTTTACAAAGAATTGGCC
TGGGTCCCTGAGGCACAAAGGAAACACACAGCCAAGAAGGCGCCCGACGGCACTGTCATCCCCAACGGC
TACTGTGACTTCTGCCTGGGGGGCTCCAAGAAGACGGGGTGTCCCGAGGACCTCATCTCCTGTGCGGAC
TGTGGGCGATCAGGACACCCCTCGTGTTTACAATTCACGGTGAACATGACGGCAGCCGTGCGGACCTAC
CGCTGGCAGTGCATCGAGTGCAAATCCTGCAGCCTGTGCGGAACCTCCGAGAACGACGGTGCCAGCTGG
GCGGGTCTCACCCCCCAGGACCAGCTGCTGTTTTGTGATGACTGCGATCGGGGTTACCACATGTACTGC
CTGAGTCCCCCCATGGCGGAGCCCCCGGAAGGGAGCTGGAGCTGTCACCTCTGTCTCCGGCACCTGAAG
GAAAAGGCTTCTGCTTACATCACCCTCACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001289978
Insert Size 1275 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289978.1
RefSeq Size 2378 bp
RefSeq ORF 1275 bp
Locus ID 8193
UniProt ID Q92782
Protein Families Druggable Genome, Transcription Factors
MW 47.8 kDa
Gene Summary May have an important role in developing neurons by participating in regulation of cell survival, possibly as a neurospecific transcription factor. Belongs to the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) represents the longest transcript and encodes the longest isoform (d). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...