Human Calumenin (CALU) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CALU
Locus ID	813
Kit Components	GA100566G1, Calumenin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAATCCGCTCCACGCAACT GA100566G2, Calumenin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGGAAAGCGCCACGTCCCC GA100566G3, Calumenin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTTAGACCAATGGCTACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001130674, NM_001199671, NM_001199672, NM_001199673, NM_001199674, NM_001219, NR_074086
Synonyms	FLJ90608
Summary	The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.