Human Fc epsilon RI (FCER1A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FCER1A
Locus ID	2205
Kit Components	GA101543G1, Fc epsilon RI gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATCAAATACTGAACCATAC GA101543G2, Fc epsilon RI gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGCTTCTGACCTTGGCAAT GA101543G3, Fc epsilon RI gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTTTTAAAGATCACTATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002001
Synonyms	FCE1A; FcERI
Summary	The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.