Human IL12A activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IL12A
Locus ID	3592
Kit Components	GA102401G1, IL12A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTTACTGCGCGGGGTCCAC GA102401G2, IL12A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTTTGCATGTCCTGCGT GA102401G3, IL12A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGCTTAGACACGGGGCGTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000882, NM_001354582, NM_001354583
Synonyms	CLMF; IL-12A; NFSK; NKSF1; P35
Summary	This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.