Human KMT2D activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	KMT2D
Locus ID	8085
Kit Components	GA105405G1, KMT2D gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCTTCCATCCCCCTCCC GA105405G2, KMT2D gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCGCCTCATTTACCGCCC GA105405G3, KMT2D gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCCGCGAAACTAGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_003482
Synonyms	AAD10; ALR; CAGL114; KABUK1; KMS; MLL2; MLL4; TNRC21
Summary	The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.