Human MAP4K4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MAP4K4
Locus ID	9448
Kit Components	GA106309G1, MAP4K4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTGTGAGTGCGTTTCCGC GA106309G2, MAP4K4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTGCCTGAGGAGGAA GA106309G3, MAP4K4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCCTCCGCCTCCGCCTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001242559, NM_001242560, NM_004834, NM_145686, NM_145687
Synonyms	FLH21957; HEL-S-31; HGK; MEKKK4; NIK
Summary	The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.