Human IGF2BP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IGF2BP1
Locus ID	10642
Kit Components	GA107292G1, IGF2BP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTCCCCAGGTCAGACCCG GA107292G2, IGF2BP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCACCACCCGGGACACTGC GA107292G3, IGF2BP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGACCATTCAAATCTCCACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001160423, NM_006546
Synonyms	CRD-BP; CRDBP; IMP-1; IMP1; VICKZ1; ZBP1
Summary	This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.