Human FOXP3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FOXP3
Locus ID	50943
Kit Components	GA109480G1, FOXP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAATCACAGGGCCAACCCG GA109480G2, FOXP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATTTTCAGATGACTCGTAA GA109480G3, FOXP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGTCTCATAATCAAGAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001114377, NM_014009
Synonyms	AIID; DIETER; IPEX; JM2; PIDX; XPID
Summary	The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene are the cause of immunodeficiency polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.