Human IL17B Receptor (IL17RB) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IL17RB
Locus ID	55540
Kit Components	GA110783G1, IL17B Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTTTTATCCCGGCGCCGC GA110783G2, IL17B Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACCTGCCCCAGCCTGGGA GA110783G3, IL17B Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGTTCGGGTGGCGGGAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_018725, NM_172234
Synonyms	CRL4; EVI27; IL17BR; IL17RH1
Summary	The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.