Human FTO activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FTO
Locus ID	79068
Kit Components	GA112344G1, FTO gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGTGAGCCCGACTTTCCA GA112344G2, FTO gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCACGGTGCACTCTAGGA GA112344G3, FTO gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCAGGGCGACGGCACACCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001080432, NM_001363905, NM_001363988, NM_001363891, NM_001363894, NM_001363896, NM_001363897, NM_001363898, NM_001363899, NM_001363900, NM_001363901, NM_001363903, NR_156761
Synonyms	ALKBH9; BMIQ14; GDFD
Summary	This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.