Human FAM167B activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FAM167B
Locus ID	84734
Kit Components	GA113679G1, FAM167B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGAAAGGAAGTTGCTCC GA113679G2, FAM167B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGCCACGTGATGCCCATC GA113679G3, FAM167B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTTCCTGGACTGCTAACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_032648
Synonyms	C1orf90

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.