Human MUC16 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MUC16
Locus ID	94025
Kit Components	GA114314G1, MUC16 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTCCAACATGAACCAGTC GA114314G2, MUC16 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCCTTTGGGACTTCACGA GA114314G3, MUC16 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGTTCCCAAGGGATGACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_024690
Synonyms	CA125
Summary	This gene encodes a protein that is a member of the mucin family. Mucins are high molecular weight, O-glycosylated proteins that play an important role in forming a protective mucous barrier, and are found on the apical surfaces of the epithelia. The encoded protein is a membrane-tethered mucin that contains an extracellular domain at its amino terminus, a large tandem repeat domain, and a transmembrane domain with a short cytoplasmic domain. The amino terminus is highly glycosylated, while the repeat region contains 156 amino acid repeats unit that are rich in serines, threonines, and prolines. Interspersed within the repeats are Sea urchin sperm protein Enterokinase and Agrin (SEA) modules, leucine-rich repeats and ankyrin (ANK) repeats. These regions together form the ectodomain, and there is a potential cleavage site found near an SEA module close to the transmembrane domain. This protein is thought to play a role in forming a barrier, protecting epithelial cells from pathogens. Products of this gene have been used as a marker for different cancers, with higher expression levels associated with poorer outcomes. [provided by RefSeq, May 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.